Cav1.3 Is Preferentially Coupled to Glucose-Induced [Ca

The link between Ca influx through the L-type calcium channels Cav1.2 or Cav1.3 and glucoseor KCl-induced [Ca 2 ]i mobilization in INS-1 cells was assessed using the calcium indicator indo-1. Cells responded to 18 mM glucose or 50 mM KCl stimulation with different patterns in [Ca ]i increases, although both were inhibited by 10 M nifedipine. Although KCl elicited a prolonged elevation in [Ca ]i, glucose triggered oscillations in [Ca ]i. Cav1.2/dihydropyridine-insensitive (DHPi) cells and Cav1.3/DHPi cells, and stable INS-1 cell lines expressing either DHP-insensitive Cav1.2 or Cav1.3 channels showed normal responses to glucose. However, in 10 M nifedipine, only Cav1.3/DHPi cells maintained glucose-induced [Ca ]i oscillation. In contrast, both cell lines exhibited DHPresistant [Ca ]i increases in response to KCl. The percentage of cells responding to glucose was not significantly decreased by nifedipine in Cav1.3/DHPi cells but was greatly reduced in Cav1.2/DHPi cells. In 10 M nifedipine, KCl-elicited [Ca 2 ]i elevation was retained in both Cav1.2/DHPi and Cav1.3/DHPi cells. In INS-1 cells expressing the intracellular II-III loop of Cav1.3, glucose failed to elicit [Ca 2 ]i changes, whereas INS-1 cells expressing the Cav1.2 II-III loop responded to glucose with normal [Ca ]i oscillation. INS-1 cells expressing Cav1.2/ DHPi containing the II-III loop of Cav1.3 demonstrated a nifedipine-resistant slow increase in [Ca ]i and nifedipine-resistant insulin secretion in response to glucose that was partially inhibited by diltiazem. Thus, whereas the II-III loop of Cav1.3 may be involved in coupling Ca 2 influx to insulin secretion, distinct structural domains are required to mediate the preferential coupling of Cav1.3 to glucose-induced [Ca 2 ]i oscillation. Insulin secretion in response to glucose in pancreatic cells requires intracellular Ca concentration ([Ca ]i) elevation. The generally accepted model is that glucose metabolism results in the activation of voltage-dependent Ca channels (VDCCs), and Ca influx causes an increase in [Ca ]i that subsequently triggers insulin exocytosis via a poorly understood mechanism. Different patterns of [Ca ]i increases have been observed in cells, which can be generally described as [Ca ]i oscillations with diverse frequency and amplitude (Theler et al., 1992; Hellman et al., 1994) or sustained [Ca ]i increases without oscillation (Grapengiesser et al., 1992; Theler et al., 1992). The contribution of both patterns of [Ca ]i increase to insulin secretion is not clear (Westerlund et al., 1997; Bergsten, 1998; Kjems et al., 2002). However, observation of a temporal correlation between [Ca ]i oscillation and insulin secretion in pancreatic cells suggests the functional importance of glucose-induced [Ca ]i oscillation (Bergsten et al., 1994; Soria and Martin, 1998; Ravier et al., 1999). The mechanisms leading to glucose-induced [Ca ]i oscillation and the source of the Ca mobilized during oscillations are not clear, although Ca influx across the plasma membrane seems to be required (Devis et al., 1975a). Among the multiple calcium-conducting channels expressed on the plasma membrane of pancreatic cells, the critical role of This work was supported by American Diabetes Association Research Award 1119990378 (to G.H.H.). ABBREVIATIONS: [Ca ]i, intracellular Ca 2 concentration; Cav1.2/II-III cells, INS-1 cells stably transfected with the Cav1.2 intracellular II-III loop fused to green fluorescent protein; Cav1.3/II-III cells, INS-1 cells stably transfected with the Cav1.3 intracellular II-III loop fused to green fluorescent protein; Cav1.2/DHPi, dihydropyridine-insensitive Cav1.2 fused to green fluorescent protein; Cav1.3/DHPi, dihydropyridine-insensitive Cav1.3 fused to green fluorescent protein; Cav1.2/DHPi/1.3II-III, dihydropyridine-insensitive Cav1.2 containing the II-III loop of Cav1.3, fused to green fluorescent protein; Cav1.2/DHPi cells, INS-1 cells stably transfected with the Cav1.2/dihydropyridine-insensitive channel; Cav1.3/DHPi cells, INS-1 cells stably transfected with the Cav1.3/dihydropyridine-insensitive channel; Cav1.2/DHPi/1.3II-III cells, INS-1 cells stably transfected with the Cav1.2/dihydropyridine-insensitive/1.3II-III channel; DHP, dihydropyridine; DHPi, dihydropyridine-insensitive; GFP, green fluorescent protein; indo-1 AM, (4-(6-carboxy-2-indolyl)-4 -methyl-2.2 -(ethylenedioxy)dianiline-N,N,N ,N -tetraacetic acid tetrakis(acetoxymethyl) ester); VDCC, voltage-dependent calcium channels; ER, endoplasmic reticulum; RT-PCR, reverse transcription-polymerase chain reaction; PCRpolymerase chain reaction; ANOVA, analysis of variance; KRBH, Krebs-Ringer-bicarbonate HEPES; MES, methanesulfonic acid. 0026-895X/04/6505-1269–1277$20.00 MOLECULAR PHARMACOLOGY Vol. 65, No. 5 Copyright © 2004 The American Society for Pharmacology and Experimental Therapeutics 2862/1146853 Mol Pharmacol 65:1269–1277, 2004 Printed in U.S.A. 1269 at A PE T Jornals on Sptem er 0, 2017 m oharm .aspeurnals.org D ow nladed from L-type VDCC in mediating [Ca ]i increase and insulin secretion has been long established (Devis et al., 1975b; Dukes and Cleemann, 1993). Previously, we reported that one isoform of L-type VDCC, Cav1.3, is preferentially coupled to glucose-induced insulin secretion (Liu et al., 2003). However, the underlying mechanism for this coupling, as well as the relative contribution of Cav1.2 (Seino et al., 1992; Horvath et al., 1998) and Cav1.3 (Seino et al., 1992) to [Ca 2 ]i mobilization in cells, is still poorly understood. Ca entry via plasma membrane channels may not exclusively account for the glucose-triggered [Ca ]i oscillation because some evidence supports the participation of the internal Ca pool in this event (Roe et al., 1993; Gilon et al., 1999; Arredouani et al., 2002). Multiple types of Ca release channels are expressed on the ER membrane of cells (Islam et al., 1992; Bruton et al., 2003; Lemmens et al., 2001). In addition to Ca influx via VDCC and Ca release from ER, multiple ion conductances may contribute to the regulation of cell membrane potential and glucose-induced [Ca ]i oscillation (Fridlyand et al., 2003). Furthermore, ATP-sensitive potassium current (Larsson et al., 1996), calcium-activated potassium current (Gopel et al., 1999), and calcium-release– activated nonselective cation current (Roe et al., 1998) may all play a role in oscillations in membrane potential that could, in turn, be influenced by the release of Ca from internal stores or the associated metabolic activity. The present study was undertaken to investigate the role of two distinct L-type VDCCs, Cav1.2 and Cav1.3, in [Ca 2 ]i changes in response to glucose or KCl stimulation in the rat pancreatic cell line INS-1. INS-1 cells express both Cav1.2 and Cav1.3 channels (Horvath et al., 1998), which are not readily differentiated by pharmacological agents. Therefore, we used INS-1 cell lines stably transfected with dihydropyridine-insensitive Cav1.2 (Cav1.2/DHPi cells) or Cav1.3 (Cav1.3/DHPi cells) channels (Liu et al., 2003). In these cell lines, endogenous L-type channels can be “turned off” with a DHP such as nifedipine, functionally isolating the drug-insensitive Cav1.2 or Cav1.3 mutant. Upon exposure to 18 mM glucose, Cav1.3/DHPi cells but not Cav1.2/DHPi cells exhibited nifedipine-resistant [Ca ]i oscillation. In contrast, DHP-insensitive [Ca ]i elevation induced by KCl was maintained in both Cav1.2/DHPi and Cav1.3/DHPi cells. Furthermore, overexpression of the intracellular loop linking domains II and III of Cav1.3 inhibited glucose-induced [Ca 2 ]i oscillation, whereas the overexpression of the corresponding loop from Cav1.2 did not. Finally, a chimeric Cav1.2/DHPi channel containing the II-III loop of Cav1.3 is more efficiently coupled to KCl-stimulated insulin secretion than is the Cav1.2/DHPi channel and is capable of mediating glucosestimulated insulin secretion but not glucose-stimulated [Ca ]i oscillations. These results indicate that the Ca 2 influx through Cav1.3 is preferentially linked to glucoseinduced [Ca ]i oscillation, and the intracellular II-III loop of Cav1.3 may be involved in this specific linkage but is not sufficient to transfer this property to Cav1.2. These data are in agreement with our previous results studying insulin secretion (Liu et al., 2003), and hence, Cav1.3-mediated [Ca 2 ]i oscillation in response to glucose is proposed as the mechanism for the coupling of Cav1.3 to glucose-stimulated insulin secretion. Materials and Methods Cell Culture and Transfection. INS-1 cells were cultured as described previously (Asfari et al., 1992). The creation and characterization of the stable INS-1 cell lines Cav1.2/DHPi, Cav1.3/DHPi, Cav1.2/II-III, and Cav1.3/II-III were reported previously (Liu et al., 2003). Cells were cultured for at least 2 weeks after thawing before experiments were performed. Because insulin secretion in INS-1 cells diminishes over time in culture, only cells between passage 30 and 80 were used in experiments. Construction of Cav1.2/DHPi/1.3II-III Channel cDNA. The IIIII loop of Cav1.2/DHPi was replaced with a short sequence containing the restriction sites HpaI and SwaI using the oligonucleotide pair (5 to 3 ) CTGGCTGATGCGGAGTCGTTAACTAATTTAAATCTCATCCTCTTCTTCATTCTG and GAAGAAGAGGATGAGATTTAAATTAGTTAACGACTCCGCATCAGCCAGGTTGTC. The II-III loop of Cav1.3 was amplified with flanking DraI (5 ) and PmlI (3 ) sites using the oligonucleotide pair (5 to 3 ) TTTATTTAAACACTGCTCAGAAAGAAGAAGCGGAAGAAAAGG and TTTACACGTGAAGATGTGGTGGTTGATGAGCTTGTGGCAGCC. The restriction sites were cut, and the Cav1.3 loop was ligated into Cav1.2/DHPi. Products were screened for the presence and orientation of the Cav1.3 II-III loop and sequenced. The chimera represents amino acids 763 to 905 of Cav1.2/DHPi replaced by amino acids 762 to 888 of Cav1.3. Stable Transfection. INS-1 cells were transfected with cDNA encoding the Cav1.2/DHPi/1.3II-III channel ligated into the plasmid vector pcDNA3 (Invitrogen, Carlsbad, CA) using GenePorterII (GeneTherapy Systems, San Diego, CA). After 3 days, 100 g/ml G418 (Promega, Madison, WI) was added to the medium. Colonies were isolated and subsequently screened by RT-PCR and Western